Human Variation and Race

1. Where there is more ultraviolet radiation, there is more melanin being produced. Melanin is what makes the skin of an individual  have a specific tint. People with darker skin have more exposure to the sun thus need to produce more melanin to protect against ultraviolet rays. Sun exposure also affects homeostasis because it helps the body prevent from sunburn and also cause DNA changes. For instance, if one is too exposed to this type of radiation they can form skin cancer.
2. When people tan and get dark skin during summer and lose it and go back to their light skin during the winter, the change in skin coloration is a seasonal acclimatization. The change is an acclimatory adjustment to the destructive effects of ultraviolet radiation from the sun.

3. This is very useful information. It helps us better understand how we adapt to our world and most of all, each other. This information can help others relate to each other and become less racist and stereotypical. Instead of one discriminating another for their different skin color, they can understand that it is only a biological production of melanin to protect them from ultraviolet rays. They can understand that it is an acclimatization and that adaption can occur with any human.
4. Most people conclude a person's race through their external look or culture. Little did they know it is mostly about their biological make up and seasonal acclimatization. I learned that skin color is from melanin and that there are two forms: pheomelanin which is red to yellow in color, and eumelanin which is dark brown to black. People with light complexioned skin mostly produce pheomelanin, while those with dark colored skin mostly produce eumelanin. Sun exposure can depend on location. Hence why Africans can be darker skin-toned than Europeans. Also people can differ in the number and size of melanin particles. Lighter skin color can also be affected by red cells in blood flowing close to the skin. Hair color is also due to the presence of melanin. It is better to be informed of the actual science of how and why we humans look different from each other. We find that we are actually all more genetically alike than we think. No matter what skin color you have, you can see it change through seasons and depending on where you go or live.

Piltdown Man Scam

1. An amateur archeologist, Charles Dawson, discovered an ape jawbone and claimed it to be part of one of the first human skulls. He dug it up in 1912 at an archaeological site in England called Piltdown.  Dawson worked with several other paleontologists and geologists such as Arthur Smith Woodward and Pierre Teilhard de Chardin to help him with his discoveries. After they found the jawbone they announced it to the Royal Geological Society which caused great enthusiasm because England never had ancient human fossils like the other countries have before. This evidence of early humans was dubbed “Piltdown man”. For 40 years people did not question this discovery because of Dawson’s and the other scientists’ prestige. However, there was still a few that were skeptical. After Dawson died, more research on evolution was made and more fossils of early humans were discovered which did not match Piltdown man’s. Finally in 1953, dating tests and stain tests were made on the bone and artifacts that revealed they were superficial and altered. The jawbone dated less than a hundred years and came from a female orangutan. Someone had forged the fossils but no one knows who the culprit was for sure. Suspects include:  Dawson, Pierre Teilhard de Chardin, Arthur Keith, Martin A. C. Hinton, Horace de Vere Cole and Arthur Conan Doyle but the truth remains unknown.

2. National pride, greed, and selfishness can all obscure the objectivity of “good science”. Scientific discovery should ultimately benefit everyone. When someone does something just for him or herself and craves fame and possibly fortune, they are putting a negative impact on the scientific process. Scientists are respected for their discoveries because it is universal to think they have good motives, especially for how much work and time they put in to discovering something new. What they share to the world really matters and is usually beneficial knowledge; to obscure that information or discovery can lead other scientists or even average people down the wrong path. Just imagine if a scientist claimed he discovered a cure for cancer. That could surely make the scientist renowned, but if it was not true, it could’ve caused other scientists to stop their efforts and that would've slowed down scientific progress. It could even make matters worse for the patients and the public because the false discovery would make science less believable. In short, science should be a practice done for the masses and not just for self-interest. If a scientist chooses to be selfish, that could stop the faith in science and slow the emergence for new, beneficial and vital information for the future.

3. The skepticism of Piltdown Man caused more scientist to use more evidence to falsify the so called “missing link” fossil. More bones were found in Asia and Africa that gave evidence of early human skulls, but ones that did not match Piltdown’s. In the 1940’s this new technology that measured the fluorine content of fossils helped date the Piltdown jaw. They found it to be much younger than a million years old. Finally in the 1950’s they had better dating methods and microscopes that showed the stains were superficial and the bones have been filed down. Using scientific methods such  as these revealed the hoax. 

4. I would definitely like to remove this “human” factor from not just science but from many industries in our world. Not only in science are people selfish but, for instance, in politics. People tend to corrupt systems with their self-interests. Many third world countries are suffering from corrupt government, leaving the majority of their people in poverty while those in the elite lie at the top. The “human” factor sometimes stops science from progressing. People rely on scientists to provide the evidence and form or prove scientific theories. If a scientist decides to care just for him or herself, then no one will benefit. As much as I would want people to stop being selfish, I don’t believe people can. It is just human nature. The best thing people could do is create a better example and hope people follow. If people practice being honest, being humble, and sharing, that can definitely improve not just science but the world.  

5. It ‘s hard not to believe scholarly scientists but I've learned that unless the information is verified by other sources and not just their own, that it is possible that there can be error to that information. In order for information to be valid, for me, it should be able to be backed up by evidence and that should be confirmed by other scientists. I believe scientists are professionals that have good intentions. Most scientists want to improve the world and provide more useful findings to better the future. But we cannot change how they are human. We certainly do have to be careful when we hear “scientifically proven” on commercials. The sources that can legitimately prove their claims and are widely accepted by other serious professionals, should be the ones to be trusted.

Body size and Sexual Dimorphism

Lemurs (Prosimians/Strepsirhini)
a. Madagascar is the home to all lemurs. They are only found there and a few islands off the coast of Africa. However, they live in a variety of habitats on those islands. Some lemurs live in moist, tropical rain forests and others in dryer areas like the desert or woodlands. The majority of lemurs spend their time in trees or bushes, hanging off branches. Others, like the ringtail lemur spends time on the ground. There are also nocturnal lemurs that are active at night and tend to stay alone.
b. There are many types of lemurs. The Indri and Diademed Sifaka lemurs are the largest and can weigh up to 15 lbs. The species of the black lemur tend to weigh about 7-9 lbs and have a body length of 22-26 inches. The smallest of lemurs is the pygmy mouse lemur and only weighs an once. On average, male and female lemurs are the same size. They measure about 1.39 ft for body size and weigh between 4-5 lbs. In the wild, it is rare for female ring-tailed lemurs to live past 16 years of age and the oldest known wild female was between 18 and 20 years old. Male life span is even less because of the social system, but have been recorded living to at least 15 years of age. Both male and female ring-tailed lemurs have scent glands. Male ring-tailed lemurs have darkly colored scent glands on the inside of their wrists and on their chests and also have spurs. Lemur sexual dimorphism is usually exhibited through different coloring.
c. Lemurs are "opportunistic omnivores" which mean they eat ripe fruits, leaves, leaf stems, flowers, flower stems, exudates, spiders, spider webs, caterpillars, cicadas, insect cocoons, birds, chameleons, cicadas, grasshoppers, and even dirt from termite mounds. To get this supply, one of their most important sources are the tamarind trees. I presume their small size makes it easy for them to scurry up trees and also get a lot of forest cover.

Sources:http://www.eskeletons.org/index.html,
http://pin.primate.wisc.edu/factsheets/entry/ring-tailed_lemur, http://tigerhomes.org/animal/lemurs.cfm, http://science.jrank.org/pages/3903/Lemurs-True-lemurs.html

Spider Monkey (New World Monkey/Platyrrhini)
a. Spider monkeys have a wide geographical distribution but can be found mostly in the tropics of Central and South America. Some also live in Brazil and the Andes mountains. Spider monkeys do not live on the ground. They live from tree to tree. They thrive in the upper canopy so they compete less with other primates on the ground.
b. They do not have thumbs however they can still grip tree branches without any limitations. They have prehensile tails which is used like an extra hand. There is a patch of skin that they have at the end of their tails which works like a finger to help increase their gripping ability. Male and female spider monkeys look similar. Males have the body length of 38-48 cm, a tail length of 63-82 cm and weighs about 9-10 kg. Females have the body length of 42-57 cm, a tail length of 75-92 cm and weighs 6-8 kg.
c. The lack of an opposable thumb is a result of their environmental adaptation. It is due to them being accustomed to travel from tree to tree in their arboreal surroundings where a thumb is not usually needed. Their tail is also another feature that helps them live their arboreal life. While they are climbing, swinging and gripping with their tail, it allows the hands to be free to gather food.

Sources:http://rainforest.montclair.edu/pwebrf/rainforest/Animals/mammals/spidermonkey.html, http://www.macalester.edu/~montgomery/spidermonkey.html, http://www.honoluluzoo.org/spider_monkey.htm, http://www.animalcorner.co.uk/rainforests/spidermonkey.html


Baboon (Old World Monkey/Cercopithecidae)
a.Baboons usually live in groups or "troops" and settle in African woodland savannas. There are some that live in Arabia. They mostly live on the ground because they do not have gripping tails but they do still climb trees to sleep or eat. They prefer the semi-arid weather of the savannas but some still do live in the tropical rain forest.
b. There are five different species of baboons. On average, the males of different species are usually 33 to 82 pounds. Baboon bodies are 20 to 40 inches long, not including tails lengths. Females are half the size of males.
c. Since baboons are flexible and can find food anywhere from  the ground, the trees, even underground, they are able to adapt to varying habitats with their strategies. They are able to extract food and nutrients from almost all strata of the environment.

sources: http://www.eskeletons.org/index.html, http://pin.primate.wisc.edu/factsheets/entry/olive_baboon, http://animals.nationalgeographic.com/animals/mammals/baboon/


Gibbon (Lesser ape/Hylobatidae)
a. Gibbons are arboreal, so they live in the trees. They mostly inhabit northern India and the islands of Indonesia.
b. There are 12 species of gibbons and are generally not sexually dimorphic in size. Females usually weigh more than mature males. They have very long arms and use them for a swinging locomotion called "brachiation". They also have very long hands and fingers. Gibbons are small and lightweight and grow to be around 90cm tall and weigh just 7kg. They look similar besides the differing colors.
c. Since gibbons are lightweight, they are able to move around and leap between the trees. Their small size also makes them more swift. Plus, their arms allow them to have a long reach. Living in the trees is also beneficial to them because the trees provide them with plenty of food supply.

sources: http://www.eskeletons.org/index.html, http://nationalzoo.si.edu/animals/primates/facts/factsheets/gibbons/default.cfm, http://a-z-animals.com/animals/gibbon/


Chimpanzee (Great ape/Hominidae)
a. Chimpanzees live in groups and inhabit most of Central and Western Africa. They can live in places ranging from humid rain-forests to swampland to grasslands to woodlands. They make nests made out of leaves and plants for sleeping in the trees. They are known for constructing.
b. Chimpanzees are our closest relative. We share 98% genetic material. Some differences include: larger ears, more protruding face, and bigger lips. For males, their weight ranges between 75-154 lbs and 55-110 lbs for females. Their height ranges from about 3-1/4 feet to 5-1/2 feet. They don't have tails.  Their arms tend to be longer than their height. They have similar hands to humans but shorter thumbs. They can pick things up with their feet.c. Chimps are able to make tools with their surroundings. They use sticks to fish and dig up termites to eat. They make hammers out of stones to crush nuts. They even use chewed up leaves to sop up water to drink. They are resourceful and intelligent.

Sources:http://www.eskeletons.org/index.html,  http://www.iearn.org.au/greatapes/chimps.htm,

Researching through all these primates, it really fascinated me that we humans lie in the same family tree as them. It is quite funny to say we are related to spider moneys. I also found that the environment greatly impacts each species' adaptions and their steps to evolving. Many of the primates above had to learn to live in the trees to avoid predators and protect their small bodies. Also, their small size helps them with their agility. Small details including a grasping tail or opposable thumbs definitely helps these animals survive as well.

Homology vs. Analogy

Homology
A homologous trait is when organisms share a trait due to common ancestry.

a. The bones of a human's front limb are homologous to the bones of a bat's front limb. 

b. Both limbs end in five digits, and even if some parts differ in size, both limbs have the same overall structure. However, they are used for different functions. It's obvious that humans cannot fly, but they use their five fingers to pick things up. Bats on the other hand, can fly but cannot pick things up with their five "fingers". 

c. All vertebrate animals (frogs, birds, fish, people) have skeletons because the ancestor of the vertebrates had a skeleton and passed that trait on to all of its descendants

Analogy

Traits that are similar due to reasons other than relatedness are called analogous. Such similarities can result from random chance or because unrelated organisms have adapted to similar environments. 

a. Although flying animals all have wings, if one would actually compare their wings, they'll find more differences than similarities. Insects have two pairs of wings, birds each have one pair. 

b. Insect wings lack bones, but a bird's wings, like an owl's, do have them. Butterfly wings are covered in scales, and bird wings in feathers. Although, they share the same function: they help the being fly. 

c. These organisms have adapted to life in the air and in doing so have evolved wings. Since wings have evolved independently in each of these groups, and don't indicate that they are closely related, the possession of wings is an analogous trait.

mRNA to DNA

GGCATATACCAACCAAACGTAAGTGTTATAGTCCGGTGAATCGAT

Historical Influences on Darwin

Jean-Baptiste Lamarck(1744-1829)

2. Though an obscure figure during his time, today the name Lamarck is recognized for forming one of the first theories about heredity, the "inheritance of acquired traits." In evolutionists perspectives he was a fine zoologist and forerunner of evolution. Even Charles Darwin wrote in 1861: 

     "Lamarck was the first man whose conclusions on the subject excited much attention. This justly celebrated naturalist first published his views in 1801. . . he first did the eminent service of arousing attention to the probability of all changes in the organic, as well as in the inorganic world, being the result of law, and not of miraculous interposition." 

3.  "Lamarckism" or "Lamarckianism" is now often used in a rather derogatory sense to refer to the theory that acquired traits can be inherited. Lamarck called the "First Law" in his book Philosophie zoologique. Lamarck's "Second Law" stated that all such changes were heritable. The result of these laws was the continuous, gradual change of all organisms, as they became adapted to their environments; the physiological needs of organisms, created by their interactions with the environment, drive Lamarckian evolution.

4. While the mechanism of Lamarckian evolution is quite different from that proposed by Darwin, the predicted result is the same: adaptive change in lineages, ultimately driven by environmental change, over long periods of time. It is interesting to note that Lamarck cited in support of his theory of evolution many of the same lines of evidence that Darwin was to use in the Origin of Species. Despite some differences, Lamarck made a major contribution to evolutionary thought, developing a theory that paralleled Darwin's in many respects. His theories from the 19th century finally gained the attention they merited. His mechanism of evolution remained a popular alternative to Darwinian selection until the beginning of the 20th century.

source:http://www.ucmp.berkeley.edu/history/lamarck.html

5. There was no sharp line between scientific issues and ideological, social and religious implications. Ideas about the transmutation of species were controversial as they conflicted with the beliefs that species were unchanging parts of a designed hierarchy and that humans were unique, unrelated to animals. The political and theological implications were intensely debated, but transmutation was not accepted by the scientific mainstream.The book produced a wide range of religious responses at a time of changing ideas and increasing secularisation. The issues raised were complex and there was a large middle ground. Developments in geology meant that there was little opposition based on a literal reading of Genesis, but defense of the argument from design and natural theology was central to debates over the book in the English speaking world.Even though the book had barely hinted at human evolution, it quickly became central to the debate as mental and moral qualities were seen as spiritual aspects of the immaterial soul, and it was believed that animals did not have spiritual qualities. This conflict could be reconciled by supposing there was some supernatural intervention on the path leading to humans, or viewing evolution as a purposeful and progressive ascent to mankind's position at the head of nature.

Source: Bowler, Peter J. (2003), Evolution: The History of an Idea (3rd ed.), University of California Press, ISBN 0-520-23693-9