mRNA to DNA

GGCATATACCAACCAAACGTAAGTGTTATAGTCCGGTGAATCGAT

Historical Influences on Darwin

Jean-Baptiste Lamarck(1744-1829)

2. Though an obscure figure during his time, today the name Lamarck is recognized for forming one of the first theories about heredity, the "inheritance of acquired traits." In evolutionists perspectives he was a fine zoologist and forerunner of evolution. Even Charles Darwin wrote in 1861: 

     "Lamarck was the first man whose conclusions on the subject excited much attention. This justly celebrated naturalist first published his views in 1801. . . he first did the eminent service of arousing attention to the probability of all changes in the organic, as well as in the inorganic world, being the result of law, and not of miraculous interposition." 

3.  "Lamarckism" or "Lamarckianism" is now often used in a rather derogatory sense to refer to the theory that acquired traits can be inherited. Lamarck called the "First Law" in his book Philosophie zoologique. Lamarck's "Second Law" stated that all such changes were heritable. The result of these laws was the continuous, gradual change of all organisms, as they became adapted to their environments; the physiological needs of organisms, created by their interactions with the environment, drive Lamarckian evolution.

4. While the mechanism of Lamarckian evolution is quite different from that proposed by Darwin, the predicted result is the same: adaptive change in lineages, ultimately driven by environmental change, over long periods of time. It is interesting to note that Lamarck cited in support of his theory of evolution many of the same lines of evidence that Darwin was to use in the Origin of Species. Despite some differences, Lamarck made a major contribution to evolutionary thought, developing a theory that paralleled Darwin's in many respects. His theories from the 19th century finally gained the attention they merited. His mechanism of evolution remained a popular alternative to Darwinian selection until the beginning of the 20th century.

source:http://www.ucmp.berkeley.edu/history/lamarck.html

5. There was no sharp line between scientific issues and ideological, social and religious implications. Ideas about the transmutation of species were controversial as they conflicted with the beliefs that species were unchanging parts of a designed hierarchy and that humans were unique, unrelated to animals. The political and theological implications were intensely debated, but transmutation was not accepted by the scientific mainstream.The book produced a wide range of religious responses at a time of changing ideas and increasing secularisation. The issues raised were complex and there was a large middle ground. Developments in geology meant that there was little opposition based on a literal reading of Genesis, but defense of the argument from design and natural theology was central to debates over the book in the English speaking world.Even though the book had barely hinted at human evolution, it quickly became central to the debate as mental and moral qualities were seen as spiritual aspects of the immaterial soul, and it was believed that animals did not have spiritual qualities. This conflict could be reconciled by supposing there was some supernatural intervention on the path leading to humans, or viewing evolution as a purposeful and progressive ascent to mankind's position at the head of nature.

Source: Bowler, Peter J. (2003), Evolution: The History of an Idea (3rd ed.), University of California Press, ISBN 0-520-23693-9